Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249747

Morpholino Name: ift52 MO1
Synonyms: IFT52
Target mRNA: ift52

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGCAATCTGTTTGTTGACTCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:172237132..172237156 21/25 Sense off-target dmxl1.L
chr1S:18501358..18501382 21/25 Antisense off-target cc2d2a.S
chr4S:39072968..39072992 21/25 Sense off-target piezo1.S
tropicalis 10.0 Chr5:4914589..4914613 21/25 unknown
Publications
First: The hydrolethalus syndrome protein HYLS-1 links core centriole structure to cilia formation., Genes Dev 2009                  
Most recent: Integration of over 9,000 mass spectrometry experiments builds a global map of human protein complexes., Mol Syst Biol 2017                          
View All Papers