Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249748

Morpholino Name: ift88 MO1
Synonyms: xPol MO, xPol-MO
Target mRNA: ift88

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCACGAGATGGACATTTTGCATCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TGATGCAAAATGTCCATCTGGTGCC 3' ||||||||||||||||||| ||||| 3' ACTACGTTTTACAGGTAGAGCACGG 5' 5' TGATGCAAAATGTCCATCTCGTGCC 3' ||||||||||||||||||||||||| 3' ACTACGTTTTACAGGTAGAGCACGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:141126325..141126349 25/25 Antisense target ift88.S
chr1S:169681246..169681270 21/25 unknown
chr1S:52518099..52518123 21/25 unknown
tropicalis 10.0 Chr2:158965796..158965820 24/25 Antisense target ift88
Publications
First: Xenopus Bicaudal-C is required for the differentiation of the amphibian pronephros., Dev Biol 2007                    
Most recent:
View All Papers