Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249749

Morpholino Name: ift88 MO2
Synonyms: Polaris, polaris MO
Target mRNA: ift88

Morpholino Type: uncategorized morpholino
Sequence: 5' GCACGAGATGGACATTTTGCATCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGATGCAAAATGTCCATCTGGTGC 3' |||||||||||||||||||| |||| 3' TACTACGTTTTACAGGTAGAGCACG 5' 5' ATGATGCAAAATGTCCATCTCGTGC 3' ||||||||||||||||||||||||| 3' TACTACGTTTTACAGGTAGAGCACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:141126326..141126350 25/25 Antisense target ift88.S
chr1S:52518100..52518124 22/25 unknown
tropicalis 10.0 Chr2:158965795..158965819 24/25 Antisense target ift88
Publications
First: The hydrolethalus syndrome protein HYLS-1 links core centriole structure to cilia formation., Genes Dev 2009                  
Most recent: Stabilization of speckle-type POZ protein (Spop) by Daz interacting protein 1 (Dzip1) is essential for Gli turnover and the proper output of Hedgehog signaling., J Biol Chem 2013                  
View All Papers