Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249750

Morpholino Name: ift88 MO3
Synonyms: ift88
Target mRNA: ift88

Morpholino Type: uncategorized morpholino
Sequence: 5' GCACCAGATGAACATTTTGCATCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25
genomic

MO
5' ATGATGCAAAATGTCCATCTGGTGC 3' |||||||||||||| |||||||||| 3' TACTACGTTTTACAAGTAGACCACG 5' 5' ATGATGCAAAATGTCCATCTCGTGC 3' |||||||||||||| ||||| |||| 3' TACTACGTTTTACAAGTAGACCACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:141126326..141126350 23/25 Antisense target ift88.S
chr2L:36551694..36551718 22/25 Antisense off-target nlgn4x.L
chr2S:1814749..1814773 22/25 Antisense off-target LOC108709161 [provisional:nlgn4x]
chr4L:2042945..2042969 21/25 Antisense off-target tub.L
chr7S:56253161..56253185 21/25 Sense off-target ncam1.S
chr9_10S:37668506..37668530 21/25 Sense off-target cox10.S
chr1L:4571240..4571264 21/25 unknown
chr4S:53605053..53605077 21/25 unknown
tropicalis 10.0 Chr2:158965795..158965819 24/25 Antisense target ift88
Chr4:89087921..89087945 22/25 Antisense off-target ptprf
Chr2:24199167..24199191 21/25 Sense off-target cadm2
Chr2:37614248..37614272 21/25 Antisense off-target nlgn4x
Chr5:46325151..46325175 21/25 Sense off-target ttc27
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers