Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249751

Morpholino Name: igf1r MO1
Synonyms: IGFR mo, MoIGF-1R
Target mRNA: igf1r

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCTTCATGTCCACAAACAAGTCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGGACTTGTTTGTGGACATGAAGGC 3' ||||||||||||||||||||||||| 3' CCCTGAACAAACACCTGTACTTCCG 5' 5' GGGACTTGTTTGTGGACATGAAGGC 3' ||||||||||||||||||||||||| 3' CCCTGAACAAACACCTGTACTTCCG 5' 5' GGGACTTGTTTGTGGACATGAAGGC 3' ||||||||||||||||||||||||| 3' CCCTGAACAAACACCTGTACTTCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:105868475..105868499 25/25 Antisense target igf1r.L
chr3S:38084481..38084505 25/25 Antisense target igf1r.S
chr3S:57173252..57173276 21/25 Antisense off-target ppcdc.S
Scaffold97109:27..51 21/25 unknown
chr5S:113489350..113489374 21/25 unknown
tropicalis 10.0 Chr3:114971883..114971907 25/25 Antisense target igf1r
Publications
First: The IGF pathway regulates head formation by inhibiting Wnt signaling in Xenopus., Dev Biol 2002                      
Most recent: Integration of IGF, FGF, and anti-BMP signals via Smad1 phosphorylation in neural induction., Genes Dev 2003  
View All Papers