Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249752

Morpholino Name: igf2bp3 MO1
Synonyms: Vg1 RBP, xVICKZ3
mRNA Target: igf2bp3

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGAAGACGAGCCCGAAAAACCCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25
genomic

MO
5' CAGGCTTTTTGGGCTCGTCTTCTTT 3' | || |||| ||||||||||||||| 3' GCCCAAAAAGCCCGAGCAGAAGAAA 5' 5' CGGGCTTTTCGGGCTCGTCTTCTTT 3' |||| |||||||||||||||||||| 3' GCCCAAAAAGCCCGAGCAGAAGAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:35119087..35119111 24/25 Antisense target igf2bp3.L
chr1L:108720808..108720832 21/25 Sense off-target fcho1.L
tropicalis 10.0 Chr6:40327835..40327859 22/25 Antisense target igf2bp3
Publications
First: The RNA-binding protein Vg1 RBP is required for cell migration during early neural development., Development 2003                
Most recent: A Novel Role for VICKZ Proteins in Maintaining Epithelial Integrity during Embryogenesis., PLoS One 2015                
View All Papers