Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249753

Morpholino Name: igf2bp3 MO2
Synonyms: Vg1RBP AMO
Target mRNA: igf2bp3

Morpholino Type: uncategorized morpholino
Sequence: 5' AAAGAAGACGAGCCCAAAAACCCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 21/24
genomic

MO
5' AGGCTTTTTGGGCTCGTCTTCTTT 3' || |||||||||||||||||||| 3' GCCCAAAAACCCGAGCAGAAGAAA 5' 5' GGGCTTTTCGGGCTCGTCTTCTTT 3' || |||| ||||||||||||||| 3' GCCCAAAAACCCGAGCAGAAGAAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:35119088..35119111 21/24 Antisense target igf2bp3.L
chr6S:60359362..60359385 20/24 unknown
tropicalis 10.0 Chr6:40327835..40327858 22/24 Antisense target igf2bp3
Chr4:47075827..47075850 20/24 Antisense off-target slc7a6os
Chr8:9434739..9434762 20/24 Sense off-target ttll11
Publications
First: RNA-binding protein Vg1RBP regulates terminal arbor formation but not long-range axon navigation in the developing visual system., Dev Neurobiol 2014  
Most recent:
View All Papers