Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249754

Morpholino Name: igfbp5 MO1
Synonyms: igfbp5
Target mRNA: igfbp5

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGCACCAACATTTCCATAGGGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 21/25
genomic

MO
5' AACCCTATGGAAATGTTGGTGCCAG 3' ||||||||||||||||||||||||| 3' TTGGGATACCTTTACAACCACGGTC 5' 5' AACCCCATGGAAATGTTGCTGCCAA 3' ||||| |||||||||||| ||||| 3' TTGGGATACCTTTACAACCACGGTC 5' 5' AACCCCTTGGAAATGTTGCTGCCAA 3' ||||| ||||||||||| ||||| 3' TTGGGATACCTTTACAACCACGGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:49051260..49051284 22/25 Antisense target igfbp5.L
chr9_10S:44735557..44735581 21/25 Antisense target igfbp5.S
chr7L:24999747..24999771 21/25 Antisense off-target slc2a9.L
chr1L:217699588..217699612 21/25 unknown
tropicalis 10.0 Chr9:86210760..86210784 25/25 Antisense target igfbp5
Chr8:54097737..54097761 21/25 Sense off-target diaph2
Chr1:172327234..172327258 21/25 unknown
Chr9:19678372..19678396 21/25 unknown
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers