Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249756

Morpholino Name: ihh MO1
Synonyms: IhhMO
Target mRNA: ihh

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCACAACCTTGGGCAACTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 23/24 24/24
genomic

MO
5' ATGCAGTTGCCCCGGGTTGTGCTG 3' |||||||||||| |||||||||| 3' TACGTCAACGGGTTCCAACACGAC 5' 5' ATGCAGTTGCCCAGGGTTGTGCTG 3' ||||||||||||| |||||||||| 3' TACGTCAACGGGTTCCAACACGAC 5' 5' ATGCAGTTGCCCAAGGTTGTGCTG 3' |||||||||||||||||||||||| 3' TACGTCAACGGGTTCCAACACGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:47527873..47527896 24/24 Antisense target ihh.S
chr9_10L:52252954..52252977 23/24 Antisense target ihh.L
chr5S:80632012..80632035 21/24 Antisense off-target arhgef10.S
tropicalis 10.0 Chr9:82974533..82974556 22/24 Antisense target ihh
Chr3:10215076..10215099 20/24 unknown
Publications
First: Indian hedgehog signaling is required for proper formation, maintenance and migration of Xenopus neural crest., Dev Biol 2012                      
Most recent: Gli2 is required for the induction and migration of Xenopus laevis neural crest., Mech Dev 2018                        
View All Papers