Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249757

Morpholino Name: ilk MO1
Synonyms: XeILK MO
Target mRNA: ilk

Morpholino Type: uncategorized morpholino
Sequence: 5' GACACTGGGCGAAAATGTCATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGATGACATTTTCGCCCAGTGTC 3' ||||||||||||||||||||||||| 3' TACCTACTGTAAAAGCGGGTCACAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:159220910..159220934 25/25 Antisense target ilk.S
chr2L:173757108..173757132 24/25 Antisense off-target MGC82989
Publications
First: Xenopus ILK (integrin-linked kinase) is required for morphogenetic movements during gastrulation., Genes Cells 2005            
Most recent:
View All Papers