Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249758

Morpholino Name: inhbb MO1
Synonyms: TNeu142f12, XtActivinbetaB
Target mRNA: inhbb

Morpholino Type: uncategorized morpholino
Sequence: 5' CACAAGCAGTAACAGGAGAGCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CATGGCTCTCCTGTTACTGCTTGTG 3' ||||||||||||||||||||||||| 3' GTACCGAGAGGACAATGACGAACAC 5' 5' CATGGCTCTCCTGTTACTGCCTCTG 3' |||||||||||||||||||| | || 3' GTACCGAGAGGACAATGACGAACAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:46347671..46347695 23/25 Antisense target inhbb.L
chr7L:22089868..22089892 21/25 Sense off-target adgra1.L
tropicalis 10.0 Chr9:89123128..89123152 25/25 Antisense target inhbb
Chr7:36377671..36377695 22/25 Antisense off-target pank1
Chr4:136050655..136050679 21/25 Sense off-target celsr3
Chr5:99975689..99975713 21/25 Antisense off-target vwa5b2
Chr7:112216283..112216307 21/25 Sense off-target mybpc2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers