Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249760

Morpholino Name: inhbb MO3
Synonyms: activinB
Target mRNA: inhbb

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAGGGTCTCCAAGCGGAGAGAGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' TCCTCTTTCCGCTCGGAGACCCTCG 3' | |||| |||||| ||||||||||| 3' AAGAGAGAGGCGAACCTCTGGGAGC 5' 5' TTCTCTCTCCGCTTGGAGACCCTCG 3' ||||||||||||||||||||||||| 3' AAGAGAGAGGCGAACCTCTGGGAGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:41998738..41998762 25/25 Antisense target inhbb.S
chr9_10L:46347610..46347634 22/25 Antisense target inhbb.L
Publications
First: Activin redux: specification of mesodermal pattern in Xenopus by graded concentrations of endogenous activin B., Development 2004                
Most recent:
View All Papers