Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249761

Morpholino Name: inhbb MO4
Synonyms: activin B MO3, activinB
Target mRNA: inhbb

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGGCGAGGGTCTCCGAGCGGAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' TTTCCGCTCGGAGACCCTCGCCGGG 3' ||||||||||||||||||||||||| 3' AAAGGCGAGCCTCTGGGAGCGGCCC 5' 5' TCTCCGCTTGGAGACCCTCGCCGGG 3' | |||||| |||||||||||||||| 3' AAAGGCGAGCCTCTGGGAGCGGCCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:46347615..46347639 25/25 Antisense target inhbb.L
chr9_10S:41998743..41998767 23/25 Antisense target inhbb.S
Publications
First: Activin redux: specification of mesodermal pattern in Xenopus by graded concentrations of endogenous activin B., Development 2004                
Most recent: Xnrs and activin regulate distinct genes during Xenopus development: activin regulates cell division., PLoS One 2007        
View All Papers