Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249762

Morpholino Name: inhbb MO5
Synonyms: activinB
Target mRNA: inhbb

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGAGGCAGTAACAGGAGAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' ATGGCTCTCCTGTTACTGCTTGTGG 3' ||||||||||||||||||| | || 3' TACCGAGAGGACAATGACGGAGACG 5' 5' ATGGCTCTCCTGTTACTGCCTCTGC 3' ||||||||||||||||||||||||| 3' TACCGAGAGGACAATGACGGAGACG 5' 5' ATGGCTCTCCCGATACTGCCTCTGC 3' |||||||||| | |||||||||||| 3' TACCGAGAGGACAATGACGGAGACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:46347672..46347696 25/25 Antisense target inhbb.L
chr9_10S:41998795..41998819 23/25 Antisense target inhbb.S
tropicalis 10.0 Chr9:89123127..89123151 22/25 Antisense target inhbb
Chr7:112216284..112216308 21/25 Sense off-target mybpc2
Publications
First: Activin redux: specification of mesodermal pattern in Xenopus by graded concentrations of endogenous activin B., Development 2004                
Most recent:
View All Papers