Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249763

Morpholino Name: inhbb MO6
Synonyms: ActivinMO
Target mRNA: inhbb

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAGGGTCTCCAAGCGGAGAGGAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 22/25
genomic

MO
5' TCCTCTTTCCGCTCGGAGACCCTCG 3' || || |||||| ||||||||||| 3' AGAGGAGAGGCGAACCTCTGGGAGC 5' 5' TTCTCTCTCCGCTTGGAGACCCTCG 3' | ||||||||||||||||||||| 3' AGAGGAGAGGCGAACCTCTGGGAGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:41998738..41998762 22/25 Antisense target inhbb.S
chr9_10L:46347610..46347634 21/25 Antisense target inhbb.L
Publications
First: Coco regulates dorsoventral specification of germ layers via inhibition of TGFβ signalling., Development 2013                
Most recent:
View All Papers