Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249764

Morpholino Name: insm1 MO1
Synonyms: insm1 UTR
Target mRNA: insm1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGTGAGTCTGGGCTGAATGCTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAAGCATTCAGCCCAGACTCACTGG 3' ||||||||||||||||||||||||| 3' TTTCGTAAGTCGGGTCTGAGTGACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:38801970..38801994 25/25 Antisense target insm1.L
chr2S:155318872..155318896 21/25 Sense off-target gdpd5.S
chr5S:25701649..25701673 21/25 unknown
Publications
First: Xenopus insm1 is essential for gastrointestinal and pancreatic endocrine cell development., Dev Dyn 2009                  
Most recent: Transient expression of Ngn3 in Xenopus endoderm promotes early and ectopic development of pancreatic beta and delta cells., Genesis 2012                          
View All Papers