Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249765

Morpholino Name: insm1 MO2
Synonyms: IA1 MO1, insm1 start
Target mRNA: insm1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTTGACCAGGAAACCTTTAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGCCTAAAGGTTTCCTGGTCAAGC 3' ||||||||||||||||||||||||| 3' TACGGATTTCCAAAGGACCAGTTCG 5' 5' ATGCCTAAAGGTTTCCTGGTCAAGC 3' ||||||||||||||||||||||||| 3' TACGGATTTCCAAAGGACCAGTTCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:38802007..38802031 25/25 Antisense target insm1.L
chr5S:29058562..29058586 25/25 Antisense target insm1.S
chr4L:32831249..32831273 22/25 unknown
chr2L:169502608..169502632 21/25 unknown
chr6L:148228815..148228839 21/25 unknown
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent: Transient expression of Ngn3 in Xenopus endoderm promotes early and ectopic development of pancreatic beta and delta cells., Genesis 2012                          
View All Papers