Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249767

Morpholino Name: insr MO1
Synonyms: moIR
Target mRNA: insr

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCCTCAATACACCCTGTCCCATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' GCATGGGACAGGGTGTATTGTGGGG 3' |||||||||||||||||||| |||| 3' CGTACCCTGTCCCACATAACTCCCC 5' 5' GCATGGGACAGGGTGTATTGAGGGG 3' ||||||||||||||||||||||||| 3' CGTACCCTGTCCCACATAACTCCCC 5' 5' GCATGGGACAGGGTGTATTGAGGGG 3' ||||||||||||||||||||||||| 3' CGTACCCTGTCCCACATAACTCCCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold21:2969714..2969738 25/25 Antisense target insr.S
chr1L:109329575..109329599 25/25 Antisense target insr.L
chr2L:173552483..173552507 21/25 Antisense off-target Xelaev18013973m
chr1S:132496313..132496337 21/25 unknown
tropicalis 10.0 Chr1:111843504..111843528 24/25 Antisense target insr
Chr8:120314892..120314916 21/25 unknown
Publications
First: Insulin receptor signaling regulates synapse number, dendritic plasticity, and circuit function in vivo., Neuron 2008  
Most recent:
View All Papers