Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249768

Morpholino Name: invs MO1
Synonyms: Invs-Mo
Target mRNA: invs

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCTACTCATACTAGAACTGGGACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGTCCCAGTTCTAGTATGAGTAGCC 3' ||||||||||||||||||||||||| 3' ACAGGGTCAAGATCATACTCATCGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8S:34668445..34668469 25/25 Antisense target invs.S
chr1S:31747586..31747610 22/25 Antisense off-target mtus1.S
chr1S:31747586..31747610 22/25 Antisense off-target LOC108706610 [provisional:mtus1]
chr7L:7865616..7865640 22/25 unknown
Publications
First: Inversin, the gene product mutated in nephronophthisis type II, functions as a molecular switch between Wnt signaling pathways., Nat Genet 2005  
Most recent: Inversin relays Frizzled-8 signals to promote proximal pronephros development., Proc Natl Acad Sci U S A 2010                            
View All Papers