Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249770

Morpholino Name: iqcb1 MO1
Synonyms: NPHP5-Mo
Target mRNA: iqcb1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCAACAGTGTCCGCCATTGTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 24/24
genomic

MO
5' AAACAATGGCCGACACTGTTGATC 3' ||||||||| ||||||||||| | 3' CTTGTTACCGCCTGTGACAACTGG 5' 5' GAACAATGGCGGACACTGTTGACC 3' |||||||||||||||||||||||| 3' CTTGTTACCGCCTGTGACAACTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:46800747..46800770 24/24 Antisense target iqcb1.L
chr5S:43028511..43028534 20/24 Sense off-target LOC108717850 [provisional:kif26b]
tropicalis 10.0 Chr9:88575677..88575700 21/24 Antisense target iqcb1
Publications
First: Genetic and physical interaction between the NPHP5 and NPHP6 gene products., Hum Mol Genet 2008    
Most recent:
View All Papers