Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249774

Morpholino Name: iqgap3 MO1
Synonyms: xIQGAP3-MO
Target mRNA: iqgap3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTCCGGCCTTACACTCCATTCCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CAGGAATGGAGTGCAAGGCGGGAGG 3' ||||||||||||| ||||| ||||| 3' GTCCTTACCTCACATTCCGGCCTCC 5' 5' CAGGAATGGAGTGTAAGGCCGGAGG 3' ||||||||||||||||||||||||| 3' GTCCTTACCTCACATTCCGGCCTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:109424782..109424806 25/25 Antisense target iqgap3.L
chr3L:138372955..138372979 21/25 unknown
tropicalis 10.0 Chr8:133180273..133180297 23/25 Antisense target iqgap3
Chr6:88366821..88366845 21/25 Antisense off-target fars2
Chr4:135263480..135263504 21/25 unknown
Publications
First: IQGAP1 functions as a modulator of dishevelled nuclear localization in Wnt signaling., PLoS One 2013                
Most recent:
View All Papers