Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249777

Morpholino Name: irs1 MO2
Synonyms: iirs-1 MO
Target mRNA: irs1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCCCACATCTCCTAATATTCATAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TTATGAATATAAGGAGATGTGGGCA 3' |||||||||| |||||||||||||| 3' AATACTTATAATCCTCTACACCCGT 5' 5' TTATGAATATTAGGAGATGTGGGCA 3' ||||||||||||||||||||||||| 3' AATACTTATAATCCTCTACACCCGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:116164389..116164413 25/25 Antisense target irs1.L
chr5S:99618535..99618559 25/25 Antisense off-target LOC108718134
tropicalis 10.0 Chr5:118798333..118798357 24/25 Antisense target irs1
Chr5:22734882..22734906 22/25 Antisense off-target nrxn1
Chr9:40495867..40495891 22/25 unknown
Chr1:97156318..97156342 21/25 unknown
Chr6:50738161..50738185 21/25 unknown
Publications
First: Xenopus laevis insulin receptor substrate IRS-1 is important for eye development., Dev Dyn 2011              
Most recent:
View All Papers