Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249778

Morpholino Name: irx1 MO1
Synonyms: MOIrx1
Target mRNA: irx1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTCTCTCCGGCAGGGAAATCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 23/25
genomic

MO
5' GCGATTTCCCTGCCGGAGAGACATG 3' ||||||||||||||||||||||||| 3' CGCTAAAGGGACGGCCTCTCTGTAC 5' 5' GCGATTTCCCTGCCGGAGAGACATG 3' ||||||||||||||||||||||||| 3' CGCTAAAGGGACGGCCTCTCTGTAC 5' 5' GCGATTCCCCTGCTGGAGAGACATG 3' |||||| |||||| ||||||||||| 3' CGCTAAAGGGACGGCCTCTCTGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:66215050..66215074 25/25 Antisense target irx1.L
chr6S:53565679..53565703 23/25 Antisense target irx1.S
chr2L:75587250..75587274 21/25 unknown
tropicalis 10.0 Chr6:68199854..68199878 25/25 Antisense target irx1
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent: The conserved barH-like homeobox-2 gene barhl2 acts downstream of orthodentricle-2 and together with iroquois-3 in establishment of the caudal forebrain signaling center induced by Sonic Hedgehog., Dev Biol 2014                      
View All Papers