Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249780

Morpholino Name: irx3 MO1
Synonyms: MOIrx3.2
Target mRNA: irx3

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGTGGGAAGGACATGGTGCAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' GCTGCACCATGTCCTTCCCACAGCT 3' ||||||||||||||||||||||||| 3' CGACGTGGTACAGGAAGGGTGTCGA 5' 5' GCTGCACCATGTCCTTCCCACAGCT 3' ||||||||||||||||||||||||| 3' CGACGTGGTACAGGAAGGGTGTCGA 5' 5' GCTGCACCATGTCCTTCCCACAACT 3' |||||||||||||||||||||| || 3' CGACGTGGTACAGGAAGGGTGTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:31936264..31936288 25/25 Antisense target irx3.L
chr4S:24047962..24047986 24/25 Antisense target irx3.S
chr3L:8177467..8177491 21/25 unknown
tropicalis 10.0 Chr4:41854008..41854032 25/25 Antisense target irx3
Chr7:106657991..106658015 21/25 Antisense off-target LOC116412469
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent: The Xenopus Irx genes are essential for neural patterning and define the border between prethalamus and thalamus through mutual antagonism with the anterior repressors Fezf and Arx., Dev Biol 2009                  
View All Papers