Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249781

Morpholino Name: irx3 MO2
Synonyms: MOIrx3
Target mRNA: irx3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTGGGAAGGACATGGTGCAGCCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' CGGCTGCACCATGTCCTTCCCACAG 3' ||||||||||||||||||||||||| 3' GCCGACGTGGTACAGGAAGGGTGTC 5' 5' CGGCTGCACCATGTCCTTCCCACAG 3' ||||||||||||||||||||||||| 3' GCCGACGTGGTACAGGAAGGGTGTC 5' 5' CGGCTGCACCATGTCCTTCCCACAA 3' |||||||||||||||||||||||| 3' GCCGACGTGGTACAGGAAGGGTGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:31936266..31936290 25/25 Antisense target irx3.L
chr4S:24047964..24047988 24/25 Antisense target irx3.S
tropicalis 10.0 Chr4:41854010..41854034 25/25 Antisense target irx3
Chr10:49239937..49239961 22/25 Sense off-target LOC100145541
Chr3:137154168..137154192 21/25 Sense off-target s1pr2
Chr5:76549498..76549522 21/25 Sense off-target lama4
Publications
First: The Xenopus Irx genes are essential for neural patterning and define the border between prethalamus and thalamus through mutual antagonism with the anterior repressors Fezf and Arx., Dev Biol 2009                  
Most recent:
View All Papers