Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249786

Morpholino Name: itgb1 MO1
Synonyms: integrin1, itgbeta1 MO
Target mRNA: itgb1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAATACTGGATAACGGGCCATCTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25 24/25
genomic

MO
5' TCAGATGGCCCGTTATTCAGTATTG 3' | |||||||||||||| ||||||| 3' ATTCTACCGGGCAATAGGTCATAAG 5' 5' TCAGATGGCCCATTATCCAGTATTC 3' | ||||||||| ||||||||||||| 3' ATTCTACCGGGCAATAGGTCATAAG 5' 5' TCAGATGGCCCGTTATCCAGTATTC 3' | ||||||||||||||||||||||| 3' ATTCTACCGGGCAATAGGTCATAAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:15984806..15984830 24/25 Antisense target itgb1.S
chr6L:19336464..19336488 23/25 Antisense target itgb1.L
chr9_10S:68547371..68547395 21/25 Antisense off-target LOC108703039 [provisional:erbb4]
chr5S:38398565..38398589 23/25 unknown
chr7L:60606212..60606236 22/25 unknown
chr5S:54695365..54695389 21/25 unknown
chr6S:105075262..105075286 21/25 unknown
tropicalis 10.0 Chr6:22881818..22881842 22/25 Antisense target itgb1
Publications
First: Cell movements of the deep layer of non-neural ectoderm underlie complete neural tube closure in Xenopus., Development 2012                          
Most recent:
View All Papers