Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249788

Morpholino Name: itpkb MO1
Synonyms:
Target mRNA: itpkb

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGGCATAACAAAATACAGCCATAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTATGGCTGTATTTTGTTATGCCTT 3' ||||||||||||||||||||||||| 3' GATACCGACATAAAACAATACGGAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:17620204..17620228 25/25 Antisense off-target itpkb-like.L
chr5S:11882549..11882573 25/25 Antisense off-target itpkb-like.S
chr3S:84531243..84531267 22/25 Sense off-target nav3.S
chr2L:178788001..178788025 21/25 Antisense off-target uvrag.L
chr2L:67337852..67337876 21/25 Sense off-target nav1.L
chr4L:109882650..109882674 21/25 unknown
tropicalis 10.0 Chr5:7799862..7799886 25/25 Antisense target itpkb
Chr5:105084940..105084964 22/25 Sense off-target fgf12
Chr1:50820477..50820501 21/25 Antisense off-target spock3
Chr1:83268080..83268104 21/25 Antisense off-target epha5
Chr2:122407767..122407791 21/25 Antisense off-target abcc4
Chr4:65493258..65493282 21/25 Sense off-target zcchc14
Chr5:94230516..94230540 21/25 Sense off-target adgrb3
Chr6:108769726..108769750 21/25 Antisense off-target gata6
Chr8:105921475..105921499 21/25 Sense off-target cdan1
Chr8:138251227..138251251 21/25 Antisense off-target cdc42se1
Chr3:82941845..82941869 22/25 unknown
Chr7:54249236..54249260 22/25 unknown
Chr1:173940514..173940538 21/25 unknown
Chr3:35673110..35673134 21/25 unknown
Chr6:128135535..128135559 21/25 unknown
Chr7:57104496..57104520 21/25 unknown
Publications
First: Inositol kinase and its product accelerate wound healing by modulating calcium levels, Rho GTPases, and F-actin assembly., Proc Natl Acad Sci U S A 2013                                        
Most recent:
View All Papers