Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249790

Morpholino Name: jarid2 MO2
Synonyms: Jarid2 MO1
Target mRNA: jarid2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTCTTGGGCCTTTCCTTGCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ATGAGCAAGGAAAGGCCCAAAAGGA 3' |||||||||||||||||||| |||| 3' TACTCGTTCCTTTCCGGGTTCTCCT 5' 5' ATGAGCAAGGAAAGGCCCAAGAGGA 3' ||||||||||||||||||||||||| 3' TACTCGTTCCTTTCCGGGTTCTCCT 5' 5' ATGAGCAAGGAAAGGCCCAAGAGGA 3' ||||||||||||||||||||||||| 3' TACTCGTTCCTTTCCGGGTTCTCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold35:1741090..1741114 25/25 Antisense target jarid2.S
chr6L:90882609..90882633 25/25 Antisense target jarid2.L
tropicalis 10.0 Chr6:92366054..92366078 24/25 Antisense target jarid2
Chr7:114361132..114361156 21/25 unknown
Publications
First: Jarid2/Jumonji coordinates control of PRC2 enzymatic activity and target gene occupancy in pluripotent cells., Cell 2009  
Most recent:
View All Papers