Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249805

Morpholino Name: kif11 MO1
Synonyms: eg5MO
Target mRNA: kif11

Morpholino Type: uncategorized morpholino
Sequence: 5' GAATTCTGGGAAGACATAGTGACCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' AGGTCACTATGTCTTCCCAGAATTC 3' ||||||||||||||||||||||||| 3' TCCAGTGATACAGAAGGGTCTTAAG 5' 5' AGATCACGATGTCTTCCCAAAATTC 3' || |||| ||||||||||| ||||| 3' TCCAGTGATACAGAAGGGTCTTAAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:20439019..20439043 25/25 Antisense target kif11.L
chr7S:15963017..15963041 22/25 Antisense target kif11.S
chr7L:23201547..23201571 21/25 Sense off-target sh3pxd2a.L
chr7L:88986453..88986477 21/25 Antisense off-target tmem51.L
chr8L:98804595..98804619 21/25 Antisense off-target zfyve26.L
chr9_10L:60016627..60016651 21/25 Antisense off-target Xelaev18044599m
tropicalis 10.0 Chr8:103525590..103525614 21/25 Antisense off-target arid4a
Publications
First: Developmental expression and role of Kinesin Eg5 during Xenopus laevis embryogenesis., Dev Dyn 2014                
Most recent: Gli2 is required for the induction and migration of Xenopus laevis neural crest., Mech Dev 2018                        
View All Papers