Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249810

Morpholino Name: kitlg MO1
Synonyms: Xsl morpholino
Target mRNA: kitlg

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTAGCTTGTCTATTATCCCCTTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/26 24/26
genomic

MO
5' CTAAGGGGATAATAGACAAGCTACCT 3' ||||||||||||||||||||||| | 3' GATTCCCCTATTATCTGTTCGATTGG 5' 5' CTAAGGGGATAATAGACAAGCTACCT 3' ||||||||||||||||||||||| | 3' GATTCCCCTATTATCTGTTCGATTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:61622665..61622690 24/26 Antisense target kitlg.L
Chr3S:92896419..92896444 24/26 unknown
tropicalis 10.0 Chr3:54626357..54626382 24/26 Antisense target kitlg
Publications
First: Ectodermally derived steel/stem cell factor functions non-cell autonomously during primitive erythropoiesis in Xenopus., Blood 2006  
Most recent:
View All Papers