Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249823

Morpholino Name: lef1 MO1
Synonyms: XtLef-1, lef1
Target mRNA: lef1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGCTCCAGAGAGCTGAGGCATGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CCATGCCTCAGCTCTCTGGAGCAGG 3' ||||||||||||||||||||||||| 3' GGTACGGAGTCGAGAGACCTCGTCC 5' 5' CCATGCCTCAGCTCTCTGGAGCAGG 3' ||||||||||||||||||||||||| 3' GGTACGGAGTCGAGAGACCTCGTCC 5' 5' CCATGCCTCAGCTCTCTGGAGCAGG 3' ||||||||||||||||||||||||| 3' GGTACGGAGTCGAGAGACCTCGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:59981143..59981167 25/25 Antisense target lef1.L
chr1S:54965881..54965905 25/25 Antisense target lef1.S
chr3L:133288100..133288124 21/25 Sense off-target LOC108710372 [provisional:cacna1a]
chr7L:14685039..14685063 22/25 unknown
tropicalis 10.0 Chr1:67039964..67039988 25/25 Antisense target lef1
Publications
First: Lef-1 and Tcf-3 transcription factors mediate tissue-specific Wnt signaling during Xenopus development., Curr Biol 2002  
Most recent: Lef1 plays a role in patterning the mesoderm and ectoderm in Xenopus tropicalis., Int J Dev Biol 2009            
View All Papers