Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249828

Morpholino Name: lefty MO2
Synonyms: Xlefty-MO2, XleftyB-MO
Target mRNA: lefty

Morpholino Type: uncategorized morpholino
Sequence: 5' GATGTGACACAGGGTGCAAGTGCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:122599046..122599070 21/25 Antisense off-target vsnl1.S
chr7L:71095541..71095565 21/25 unknown
tropicalis 10.0 Chr2:136926886..136926910 22/25 Antisense off-target spats2
Chr5:141991868..141991892 21/25 Antisense off-target kcns3
Chr6:39871835..39871859 21/25 Antisense off-target rapgef5
Chr4:119402367..119402391 21/25 unknown
Chr6:104823122..104823146 21/25 unknown
Publications
First: Lefty-dependent inhibition of Nodal- and Wnt-responsive organizer gene expression is essential for normal gastrulation., Curr Biol 2002                
Most recent: Cooperative non-cell and cell autonomous regulation of Nodal gene expression and signaling by Lefty/Antivin and Brachyury in Xenopus., Dev Biol 2006                          
View All Papers