Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249840

Morpholino Name: lgr5 MO2
Synonyms:
Target mRNA: lgr5

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCTGCTCTAATGGTGCAGGCTAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 23/25
genomic

MO
5' TTTAGCCTGCACCATTAGAGCAGCG 3' ||||||||||||||||||||||||| 3' AAATCGGACGTGGTAATCTCGTCGC 5' 5' TTTAGTCTGTCCCATTAGAGCAGCG 3' ||||| ||| |||||||||||||| 3' AAATCGGACGTGGTAATCTCGTCGC 5' 5' TTTAGCCTGTCCCATTAGAGCAGCG 3' ||||||||| |||||||||||||| 3' AAATCGGACGTGGTAATCTCGTCGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:88183518..88183542 23/25 Antisense target lgr5.S
Chr3L:66542672..66542696 22/25 Antisense target lgr5.L
tropicalis 10.0 Chr3:59771221..59771245 25/25 Antisense target lgr5
Publications
First: LGR4 and LGR5 are R-spondin receptors mediating Wnt/β-catenin and Wnt/PCP signalling., EMBO Rep 2011  
Most recent:
View All Papers