Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249841

Morpholino Name: lgr5 MO3
Synonyms:
Target mRNA: lgr5

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTTGAAAGGTCCTAGGGAGAAAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CTTTTCTCCCTAGGACCTTTCAAGC 3' ||||||||||||||||||||||||| 3' GAAAAGAGGGATCCTGGAAAGTTCG 5' 5' CTTTTCTCTATAGGACCTTTCAAGC 3' |||||||| ||||||||||||||| 3' GAAAAGAGGGATCCTGGAAAGTTCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:88073488..88073512 23/25 Antisense target lgr5.S
Chr8L:104841977..104842001 21/25 unknown
tropicalis 10.0 Chr3:59873669..59873693 25/25 Antisense target lgr5
Chr1:189837970..189837994 21/25 Sense off-target pde4d
Chr8:59619003..59619027 21/25 unknown
Publications
First: LGR4 and LGR5 are R-spondin receptors mediating Wnt/β-catenin and Wnt/PCP signalling., EMBO Rep 2011  
Most recent:
View All Papers