Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249924

Morpholino Name: msx2 MO1
Synonyms: Msx2 MO, msx2 splice blocking morpholino
Target mRNA: msx2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCTCAGGTGTCCTAAAAAAGAGAGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 26/27 27/27
genomic

MO
5' CTCTCTCTTTTTTAGGACACCTGAGCC 3' | ||||||||||||||||||||||||| 3' GTGAGAGAAAAAATCCTGTGGACTCGG 5' 5' CACTCTCTTTTTTAGGACACCTGAGCC 3' ||||||||||||||||||||||||||| 3' GTGAGAGAAAAAATCCTGTGGACTCGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:104444542..104444568 27/27 Antisense target msx2.S
Chr3L:50097804..50097830 26/27 Antisense target msx2.L
Publications
First: Msx1 and Msx2 have shared essential functions in neural crest but may be dispensable in epidermis and axis formation in Xenopus., Int J Dev Biol 2006            
Most recent: Median facial clefts in Xenopus laevis: roles of retinoic acid signaling and homeobox genes., Dev Biol 2012                                
View All Papers