Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249978

Morpholino Name: nradd MO1
Synonyms:
Target mRNA: nradd

Morpholino Type: uncategorized morpholino
Sequence: 5' GGATCTGGCCTCTCTCCTCCCAGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACCTGGGAGGAGAGAGGCCAGATCC 3' ||||||||||||||||||||||||| 3' TGGACCCTCCTCTCTCCGGTCTAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:43278682..43278706 21/25 Sense off-target cnksr2.L
chr4S:68231494..68231518 21/25 Sense off-target trabd2b.S
Scaffold93371:74..98 21/25 unknown
chr6S:116647280..116647304 21/25 unknown
tropicalis 10.0 Chr6:12433874..12433898 25/25 Antisense target nradd
Chr8:2572483..2572507 21/25 Antisense off-target slc31a1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development., Dev Biol 2006                    
View All Papers