Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249979

Morpholino Name: nradd MO2
Synonyms: NRH Mo, XLNRH1b MOB1
Target mRNA: nradd

Morpholino Type: uncategorized morpholino
Sequence: 5' GGATCTGGCCTCGTTCCTGTTCAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CCTGAACAGGAACGAGGCCAGATCC 3' ||||||||||||||||||||||||| 3' GGACTTGTCCTTGCTCCGGTCTAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:3344375..3344399 25/25 Antisense target nradd.S
Publications
First: FGF signal regulates gastrulation cell movements and morphology through its target NRH., Dev Biol 2005                            
Most recent: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development., Dev Biol 2006                    
View All Papers