Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249980

Morpholino Name: nradd MO3
Synonyms: XLNRH1b MOB2, ngfr MO3
Target mRNA: nradd

Morpholino Type: uncategorized morpholino
Sequence: 5' TGATCTCTTCTCCTGGAATCTTTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/26
genomic

MO
5' GGAGAAGATTCCAGGAGAAGAGATCA 3' | |||||||||||||||||||||| 3' CTCTTTCTAAGGTCCTCTTCTCTAGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:3344342..3344367 23/26 Antisense target nradd.S
chr5L:113213648..113213673 22/26 unknown
tropicalis 10.0 Chr8:2930105..2930130 22/26 Antisense off-target exd3
Chr4:141362852..141362877 22/26 unknown
Chr9:24340662..24340687 22/26 unknown
Publications
First: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development., Dev Biol 2006                    
Most recent:
View All Papers