Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249981

Morpholino Name: nradd MO4
Synonyms: NRH1a-MO, XLNRH1a MOB1, ngfr MO4
Target mRNA: nradd

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCTCTTTCCTTCCCGGTTTTCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTGAAAACCGGGAAGGAAAGAGGAT 3' ||||||||||||||||||||||||| 3' GACTTTTGGCCCTTCCTTTCTCCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:3865955..3865979 25/25 Antisense target nradd.L
chr6L:143326304..143326328 21/25 Sense off-target Xelaev18032363m
Scaffold136:130498..130522 22/25 unknown
Scaffold29:93760..93784 22/25 unknown
chr2S:21064341..21064365 21/25 unknown
chr7S:62164229..62164253 21/25 unknown
Publications
First: The neurotrophin-receptor-related protein NRH1 is essential for convergent extension movements., Nat Cell Biol 2004  
Most recent: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development., Dev Biol 2006                    
View All Papers