Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249984

Morpholino Name: nradd MO7
Synonyms: NRH1 intron1 mo, intron 1 MO, ngfr MO7
Target mRNA: nradd

Morpholino Type: uncategorized morpholino
Sequence: 5' AGAGAGAAAGCCCACCTTGGAGATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GATCTCCAAGGTGGGCTTTCTCTCT 3' ||||||||||||||||||||||||| 3' CTAGAGGTTCCACCCGAAAGAGAGA 5' 5' GATCTCCAAGGTGGGCTCACTCTCT 3' ||||||||||||||||| |||||| 3' CTAGAGGTTCCACCCGAAAGAGAGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:3866031..3866055 23/25 Antisense target nradd.L
chr6L:151108879..151108903 21/25 unknown
tropicalis 10.0 Chr6:12433802..12433826 25/25 Antisense target nradd
Chr2:973544..973568 21/25 Antisense off-target Xetrov107012166m.g
Chr2:973544..973568 21/25 Antisense off-target LOC101734364
Publications
First: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development., Dev Biol 2006                    
Most recent:
View All Papers