Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249988

Morpholino Name: nipbl MO1
Synonyms: Nipbl, TEgg076c16, delangin
Target mRNA: nipbl

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGTAGGATGGTGGTATCTATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' GCATAGATACCACCATCCTACAGCT 3' ||||||||||||||||||||||||| 3' CGTATCTATGGTGGTAGGATGTCGA 5' 5' GCGTAGATACCACCATCCTACAGCT 3' || |||||||||||||||||||||| 3' CGTATCTATGGTGGTAGGATGTCGA 5' 5' GCATAGATACCACCATCCTACAGCT 3' ||||||||||||||||||||||||| 3' CGTATCTATGGTGGTAGGATGTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1S:166564020..166564044 25/25 Antisense target nipbl.S
chr1L:202124633..202124657 24/25 Antisense target nipbl.L
tropicalis 10.0 Chr1:197912182..197912206 25/25 Antisense target nipbl
Publications
First: Metazoan Scc4 homologs link sister chromatid cohesion to cell and axon migration guidance., PLoS Biol 2006                  
Most recent: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
View All Papers