Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249998

Morpholino Name: nkx6-2 MO1
Synonyms: nkx6.2
Target mRNA: nkx6-2

Morpholino Type: uncategorized morpholino
Sequence: 5' CACGGATAACATTGGGCAACATGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 21/25
genomic

MO
5' TCCATGCTGCCCAATGTTAGCCGTG 3' |||||| |||||||||||| ||||| 3' AGGTACAACGGGTTACAATAGGCAC 5' 5' TCCATGTTGCCCAATGTTATCCGTG 3' ||||||||||||||||||||||||| 3' AGGTACAACGGGTTACAATAGGCAC 5' 5' CTCATGCTCCCCAATGTTATCCGTG 3' |||| | |||||||||||||||| 3' AGGTACAACGGGTTACAATAGGCAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:15310037..15310061 25/25 Antisense target nkx6-2.L
chr7S:11556547..11556571 21/25 Antisense target nkx6-2.S
chr7S:86082263..86082287 21/25 Sense off-target igsf21.S
chr7S:86082645..86082669 21/25 Sense off-target igsf21.S
tropicalis 10.0 Chr7:20487483..20487507 23/25 Antisense target nkx6-2
Publications
First: Xenopus Nkx6.1 and Nkx6.2 are required for mid-hindbrain boundary development., Dev Genes Evol 2013  
Most recent: Prdm12 specifies V1 interneurons through cross-repressive interactions with Dbx1 and Nkx6 genes in Xenopus., Development 2015                                      
View All Papers