Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250011

Morpholino Name: nodal5.2 MO1
Synonyms: Xnr5 MOa, Xnr5MO, xnr5, xnr5 MO
Target mRNA: nodal5.2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGATAAAGCCTAGCACAGCCATATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATATGGCTGTGCTAGGCTTTATCT 3' ||||||||||||||||||||||||| 3' CTATACCGACACGATCCGAAATAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:124090019..124090043 25/25 Antisense target nodal5.2.L
chr3L:124060867..124060891 25/25 Antisense off-target LOC108711635
chr3L:124067268..124067292 25/25 Antisense off-target nodal5.L
chr3L:124084161..124084185 24/25 Antisense off-target nodal5.L
chr9_10L:115684342..115684366 21/25 unknown
tropicalis 10.0 Chr3:130798077..130798101 24/25 Antisense off-target nodal5
Chr3:130807671..130807695 24/25 Antisense off-target LOC100490072
Chr3:130811198..130811222 24/25 Antisense off-target LOC116409495
Chr3:130816889..130816913 24/25 Antisense off-target LOC101734231
Chr3:130822706..130822730 24/25 Antisense off-target LOC101734157
Chr1:22687135..22687159 21/25 Sense off-target grk4
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent: Coco regulates dorsoventral specification of germ layers via inhibition of TGFβ signalling., Development 2013                
View All Papers