Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250015

Morpholino Name: nog MO1
Synonyms: Nog MO, Nog-MO, Noggin, Noggin MO, Noggin-MO, Noggin1, Noggin1 MO, nMO
Target mRNA: nog

Morpholino Type: uncategorized morpholino
Sequence: 5' TCACAAGGCACTGGGAATGATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGATCATTCCCAGTGCCTTGTGA 3' ||||||||||||||||||||||||| 3' TACCTAGTAAGGGTCACGGAACACT 5' 5' ATGGATCATTCCCAGTGCCTTGTGA 3' ||||||||||||||||||||||||| 3' TACCTAGTAAGGGTCACGGAACACT 5' 5' ATGGATCATTCCCAGTGCCTTGTGA 3' ||||||||||||||||||||||||| 3' TACCTAGTAAGGGTCACGGAACACT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:32767901..32767925 25/25 Antisense target nog.L
Chr9_10S:28716977..28717001 25/25 Antisense target nog.S
Chr3S:4117787..4117811 22/25 Antisense off-target LOC108712551
tropicalis 10.0 Chr10:25898656..25898680 25/25 Antisense target nog
Publications
First: Dkk1 and noggin cooperate in mammalian head induction., Genes Dev 2003  
Most recent: Novel functions of Noggin proteins: inhibition of Activin/Nodal and Wnt signaling., Development 2011                
View All Papers