Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250017

Morpholino Name: nono MO1
Synonyms: Xp54nrb
Target mRNA: nono

Morpholino Type: uncategorized morpholino
Sequence: 5' GTACCCTCTGTTTCCCTGCATGTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AAAAATGCAGGGCAACAGAGGGTAC 3' ||| |||||||| |||||||||||| 3' TTTGTACGTCCCTTTGTCTCCCATG 5' 5' AAACATGCAGGGAAACAGAGGGTAC 3' ||||||||||||||||||||||||| 3' TTTGTACGTCCCTTTGTCTCCCATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:21824699..21824723 25/25 Antisense target nono.L
chr9_10L:35993727..35993751 21/25 Antisense off-target LOC100495379.L
chr3S:39266488..39266512 22/25 unknown
chr3L:61988617..61988641 21/25 unknown
chr3L:77914173..77914197 21/25 unknown
chr5L:8334117..8334141 21/25 unknown
chr8L:71621413..71621437 21/25 unknown
tropicalis 10.0 Chr8:44281685..44281709 23/25 Antisense target nono
Chr7:90176712..90176736 21/25 Antisense off-target plch2
Publications
First: The RNA-binding protein Xp54nrb isolated from a Ca²+-dependent screen is expressed in neural structures during Xenopus laevis development., Int J Dev Biol 2011          
Most recent: Role of the visual experience-dependent nascent proteome in neuronal plasticity., Elife 2018                      
View All Papers