Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250018

Morpholino Name: notch1 MO1
Synonyms: Notch Mo, Notch1 MO, Xotch Mo
Target mRNA: notch1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCACAGCCAGCCCTATCCGATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25
genomic

MO
5' ATGGATCGGATAGGGCTGCTTGTGC 3' |||||||||||||||||| ||||| 3' TACCTAGCCTATCCCGACCGACACG 5' 5' ATGGATCGGATAGGACTGGCTGTGC 3' |||||||||||||| |||||||||| 3' TACCTAGCCTATCCCGACCGACACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8S:29141641..29141665 24/25 Antisense target notch1.S
chr8L:4222615..4222639 23/25 Antisense target notch1.L
chr4S:40856299..40856323 21/25 Antisense off-target zfhx3.S
tropicalis 10.0 Chr8:134634650..134634674 21/25 Sense off-target LOC100496798
Publications
First: Notch activates sonic hedgehog and both are involved in the specification of dorsal midline cell-fates in Xenopus., Development 2003          
Most recent: Notch1 is asymmetrically distributed from the beginning of embryogenesis and controls the ventral center., Development 2018                            
View All Papers