Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250019

Morpholino Name: nphp3 MO1
Synonyms: NPHP3-MO
Target mRNA: nphp3

Morpholino Type: uncategorized morpholino
Sequence: 5' TAACCAGAGAAGAGGCTGTCCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGGGACAGCCTCTTCTCTGGTTA 3' ||||||||||||||||||||||||| 3' TACCCCTGTCGGAGAAGAGACCAAT 5' 5' ATGGGGACAGCCTCTTCTCTGGTTA 3' ||||||||||||||||||||||||| 3' TACCCCTGTCGGAGAAGAGACCAAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6L:51116096..51116120 25/25 Antisense target nphp3.L
chr4L:88085353..88085377 21/25 Sense off-target rc3h1.L
chr4S:71561403..71561427 21/25 Sense off-target rc3h1.S
tropicalis 10.0 Chr6:52867592..52867616 25/25 Antisense target nphp3
Chr4:61513992..61514016 21/25 Antisense off-target cdh3
Chr4:98035423..98035447 21/25 Sense off-target rc3h1
Chr8:138634485..138634509 21/25 Sense off-target LOC100486737
Chr8:138634485..138634509 21/25 Antisense off-target LOC101730711
Chr8:138660565..138660589 21/25 unknown
Publications
First: Loss of nephrocystin-3 function can cause embryonic lethality, Meckel-Gruber-like syndrome, situs inversus, and renal-hepatic-pancreatic dysplasia., Am J Hum Genet 2008  
Most recent:
View All Papers