Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250063

Morpholino Name: pax2 MO1
Synonyms: pax2-specific morpholino1
Target mRNA: pax2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGCAGTGCATATCCATGGGGAGGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TGCCTCCCCATGGATATGCACTGCA 3' ||||||||||||||||||||||||| 3' ACGGAGGGGTACCTATACGTGACGT 5' 5' TGCCTCCCCATGGATATGCACTGCA 3' ||||||||||||||||||||||||| 3' ACGGAGGGGTACCTATACGTGACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:38376473..38376497 25/25 Antisense target pax2.L
chr7S:30650367..30650391 25/25 Antisense off-target LOC108697493
chr2S:7845414..7845438 21/25 Antisense off-target mospd2.S
tropicalis 10.0 Chr7:43096829..43096853 25/25 Antisense target pax2
Chr7:89175385..89175409 21/25 unknown
Publications
First: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain., Dev Biol 2010                    
Most recent: Hedgehog-dependent E3-ligase Midline1 regulates ubiquitin-mediated proteasomal degradation of Pax6 during visual system development., Proc Natl Acad Sci U S A 2016                      
View All Papers