Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250068

Morpholino Name: pax3 MO4
Synonyms: Pax3, Pax3-MO-mis, Pax3MO
Target mRNA: pax3

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CAGCCAAGCTGGTCATCATCAGTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' GACCTGATGATGACCAGCTTGGCTG 3' || |||||||||||||||||||||| 3' CTTGACTACTACTGGTCGAACCGAC 5' 5' GAACTGATGATGACCAGCTTGGCTG 3' ||||||||||||||||||||||||| 3' CTTGACTACTACTGGTCGAACCGAC 5' 5' GAACTGAGAATGACCAGCTTGGCTG 3' ||||||| |||||||||||||||| 3' CTTGACTACTACTGGTCGAACCGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:123000879..123000903 25/25 Antisense target pax3.L
chr5S:105927867..105927891 23/25 Antisense target pax3.S
chr5L:142100589..142100613 21/25 Antisense off-target kcns3.L
chr5L:142100589..142100613 21/25 Antisense off-target LOC108717192 [provisional:gen1]
tropicalis 10.0 Chr5:124996535..124996559 24/25 Antisense target pax3
Publications
First: A Meis family protein caudalizes neural cell fates in Xenopus., Mech Dev 1999            
Most recent: A novel function for Egr4 in posterior hindbrain development., Sci Rep 2015                                
View All Papers