Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250077

Morpholino Name: pcdh7 MO1
Synonyms: NFPC MO
Target mRNA: pcdh7

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGTGTCCCCTCAGTCCTCATCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGATGAGGACTGAGGGGACACAGA 3' ||||||||||||||||||||||||| 3' TACTACTCCTGACTCCCCTGTGTCT 5' 5' ATGATGAGGACTGAGGGGACACAGA 3' ||||||||||||||||||||||||| 3' TACTACTCCTGACTCCCCTGTGTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:35140504..35140528 25/25 Antisense target pcdh7.L
Chr1S:23256659..23256683 25/25 Antisense target pcdh7.S
tropicalis 10.0 Chr7:16592259..16592283 22/25 Antisense off-target ank3
Publications
First: The cytoplasmic domain of Xenopus NF-protocadherin interacts with TAF1/set., Dev Cell 2003    
Most recent: Neural crest development in Xenopus requires Protocadherin 7 at the lateral neural crest border., Mech Dev 2018                  
View All Papers